Translate this page into:
Assessment of the inherent chondrogenic potential of human articular cartilage-derived chondroprogenitors in pellet culture using a novel whole pellet processing approach
, Soosai Manickam Amirthama, B. Sandya Ranib, Solomon Sathishkumara, Grace Rebekahc, Elizabeth Vinoda,b,
∗Corresponding author: Elizabeth Vinod. elsyclarence@cmcvellore.ac.in
-
Received: ,
Accepted: ,
This article was originally published by Reed Elsevier India Pvt. Ltd. and was migrated to Scientific Scholar after the change of Publisher.
Abstract
Abstract
Cartilage-derived chondroprogenitors have been reported to possess the biological potential for cartilage repair. However, its inherent chondrogenic potential in pellet culture needs evaluation. In-vitro cartilage regeneration models based on pellet cultures have been employed to evaluate the chondrogenic potential of stem cells. Evaluation of the degree of differentiation routinely involves paraffin embedding, sectioning, and immunohistochemical staining of the pellet. However, since chondrogenic differentiation is commonly non-uniform, processing random sections could lead to inaccurate conclusions. The study aimed at assessing the inherent lineage bias of chondroprogenitors with and without chondrogenic induction, using a novel whole pellet processing technique.
Human chondroprogenitors (n=3) were evaluated for MSC markers and processed in pellet cultures either with stromal medium (uninduced) or chondrogenic differentiation medium (induced) for 28 days. The whole pellets and the conventional paraffin-embedded sectioned pellets were subjected to Collagen type II immunostaining and assessed using confocal laser microscopy. The staining intensities of the whole pellet were compared to the paraffin sections and revalidated using qRT-PCR for COL2A1 expression.
Uninduced and induced pellets displayed Collagen type II in all the layers with comparable fluorescence intensities. COL2A1 expression in both pellets was comparable to confocal results. The study demonstrated that uninduced chondroprogenitors in pellet culture possess promising inherent chondrogenic potential. Confocal imaging of whole pellets displayed different degrees of chondrogenic differentiation in the entire pellet, thus its probable in-vivo behavior.
The novel approach presented in this study could serve as an efficient in-vitro alternative for understanding translational application for cartilage repair.
Abstract
Highlights
•Uninduced chondroprogenitors display inherent chondrogenesis.•Novel whole pellet approach for collagen type II processing.•Efficient alternative to paraffin section processing of pellets.
Keywords
Whole pellet
Chondrogenic differentiation
Confocal
Collagen type II
1 Introduction
Articular cartilage forms an integral part of the human skeleton system. This specialized connective tissue, which is composed of hyaline cartilage, serves to provide an almost frictionless articulation in the joints, whilst also ensuring load transmission to the underlying bone.1 However, its relative avascular and aneural nature hinders its self-healing ability. In the field of cartilage repair and regeneration, cell-based therapy employing chondrocytes and Mesenchymal Stem Cells (MSCs) have gained wide recognition.2 Despite the positive outcomes, the major drawback limiting its long-term effectiveness is forming a fibro-hyaline type of repair tissue, which is inferior in terms of function compared to the original hyaline cartilage.3–6 Thus, the search for alternative cells with enhanced chondrogenesis and a lower inclination for hypertrophy are being investigated.
Articular cartilage-derived chondroprogenitors have been likened to MSCs, conforming to the minimal criteria proposed by the International Society for Cellular Therapy, 2006.7–10 They are commonly isolated by subjecting chondrocytes to fibronectin adhesion assay.11 Compared to BM-MSCs and chondrocytes, a few reports show that chondroprogenitors exhibit significantly lower hypertrophy markers (RUNX2 and Collagen type X), thus displaying reduced inclination towards fibrocartilage formation.12,13 Concerning their chondrogenic potential, multiple reports have shown higher expression of chondrogenic genes (SOX9 and Collagen type II) and potential surface markers of enhanced chondrogenesis (CD146 and CD166).9,10,14,15
Pellet or micro mass cultures are gold-standard techniques used for evaluating the chondrogenic potential of MSCs.16,17 It closely mimics the native cartilage microenvironment and helps predict their probable behavior post-transplantation. In the presence of glucocorticoids and additional growth factors, the pellet culture technique enables the cells to undergo aggregation, condensation, and differentiation, followed by secretion of glycosaminoglycans and extracellular matrix namely collagen type II protein. Histological processing of the pellets involves formaldehyde fixation, followed by paraffin embedding, and microtome sectioning (4–5 μm) of the whole pellets. Assessment of the degree of chondrogenic differentiation involves staining the sections for glycosaminoglycan deposition and Collagen Type II using immunohistological staining. During processing, random sections are taken according to the researcher or technician's discretion and processed further for staining, since staining the entire paraffin-embedded pellet is unfeasible. One of the drawbacks encountered with the pellet culture system is that different regions undergo uneven degrees of chondrogenic differentiation.18,19 Therefore, extrapolation of results based on the staining obtained with a single section may provide misleading information. To our knowledge based on existing literature, a method to analyze the chondroprogenitor pellet as a whole has not been attempted thus far. Analyzing the entire pellet will provide conglomerated information on the chondrogenic ability of the cell type under evaluation.
Previous literature reports as described above show that uninduced, monolayer expanded chondroprogenitors show intrinsic chondrogenic ability. However, the intrinsic chondrogenic potential of uninduced chondroprogenitors in pellet culture needs evaluation. Thus, the study objective was to assess the inherent lineage bias of human articular cartilage-derived chondroprogenitors towards chondrogenic differentiation, employing the 3D pellet culture system, and comparing both the chondrogenic induced and uninduced pellets. Towards this, the whole pellets were subjected to Collagen type II immunostaining and assessed using confocal laser microscopy. Furthermore, the study compared the Collagen type II staining intensities of the whole pellets to the sections obtained by the conventional paraffin-based approach and revalidated the results using quantitative reverse transcription-polymerase chain reaction (qRT-PCR) for COL2A1 expression.
2 Methods and materials
2.1 Study design
All procedures followed the Institutional Ethics Committee guidelines and were conducted following Institutional Review Board approval. After obtaining written informed consent, human articular cartilage was harvested from three osteoarthritic knee joints (Age, mean ± standard deviation: 55 ± 4 years). Knee joints with a radiological Kellgren-Lawrence score of grade 4, requiring total knee replacement as part of the treatment were only included. Joints with tumor, inflammation, or infection were excluded. To obtain chondroprogenitors, cartilage slices were enzymatically digested, and the released cells were subjected to fibronectin adhesion assay. The clonal cells were further cultured to passage 1 and characterized for positive and negative MSC markers using fluorescence-activated cell sorting (FACS). Following this, the chondroprogenitors were pelleted at a concentration of 0.5 × 106 cells/microcentrifuge tube and subjected to either one of the following culture conditions, a) Uninduced (stromal medium) or b) Induced (chondrogenic differentiation medium). The assessment arms for estimating Collagen type II expression included confocal laser scanning microscopy of the whole pellets and paraffin sections, and qRT-PCR of the homogenized pellets for expression of COL2A1. Sequential optical sections of the whole pellet/paraffin sections were further processed to generate multi-dimensional/z-series views. Quantification of fluorescence intensity of the Z-stack images was performed using Cell Sans software (Fig. 1).
2.2 Isolation and culture of chondroprogenitors
To obtain individual chondrocytes, minced cartilage shavings were subjected to sequential enzymatic digestion with 12 IU pronase for 3 h (Mat no: 10165913103, Roche), followed by 100 IU collagenase type II (Worthington) digestion for 12–14 h at 37 °C. The released cells were subjected to fibronectin differential adhesion (Cat no: F1141, Sigma Aldrich, US) for 20 min at a concentration of 4000 cells/9.3 cm2. Post incubation, non-adherent cells were removed and replaced with stromal growth media [DMEM-F12 containing 10% fetal bovine serum (FBS, Invitrogen) 0.1 mM ascorbic acid (Sigma), 2.4 mM/l-glutamine (Sigma), antibiotics, and antimycotic. The adherent cells grew clonally achieving a population doubling of 5 by day 12. The polyclonal enriched cultures were expanded to passage 1 using the aforementioned stromal medium including human recombinant fibroblastic growth factor FGF-2 (bFGF2 at 5 ng/ml, Cat no: 4037, Biovision, San Francisco, US) and transforming growth factor beta-2 (TGFβ2 at 1 ng/ml, Cat no: 4343-5 Biovision, San Francisco, US). The stromal medium was renewed once every three days.
2.3 Phenotyping by FACS
Chondroprogenitors were characterized with the following mouse Anti-human antibodies: a) positive MSC markers: CD105-FITC, CD73-PE, CD90-PE b) negative MSC markers: CD34-PE, CD45-FITC, and c) integrin markers: CD49e-PE, CD29APC (Table S1). Each antibody was stained according to its manufacturer's instructions. Data acquisition was performed on Beckman Coulter Cytoflex LX flow cytometer using Cytexpert software and analysis was done using FlowJo V 10.7.
2.4 Pellet cultures
Passage 1 chondroprogenitors at a concentration of 0.5 × 106 cells/2 ml microcentrifuge tubes, were centrifuged at 400 g for 12 min to form a pellet and allowed to aggregate for a period of 36 h. The uninduced study arm included the addition of stromal medium (DMEM-F12 + 10% FBS) to the pellet, while the induced arm included the addition of chondrogenic differentiation medium (StemPro Thermo Fischer Scientific, Cat no: A1007101). The supernatant was changed once every 3 days for a period of 28 days.
2.5 Pellet processing
2.5.1 Whole pellet
The procedures for staining were performed within the contained microcentrifuge tube. Following phosphate-buffered saline (PBS) wash, the pellets were fixed for 15 min using 4% paraformaldehyde. For antigen retrieval, pellets were washed with 0.01% PBST (0.1% tritonX100 in PBS) and incubated sequentially with 1 mg/mL pronase in PBS and 5 mg/ml hyaluronidase at 37 °C for 30 min each. This was followed by a protein block using 1% bovine serum albumin (BSA) and 6% FBS for 30 min. Overnight primary antibody incubation was performed using mouse monoclonal Anti-Collagen type II antibody [DSHB Hybridoma Product II-II6B3-5 μg/mL] reconstituted with 2% BSA in PBS at 4 °C. Following this, the pellets were washed and treated with protein block solution (0.5% BSA and 3% FBS) for 5 min and secondary antibody IgG (H + L) highly cross-adsorbed Goat anti-Mouse, Alexa Fluor® 594, Invitrogen (Catalogue no: A11032, 1:100 dilution) for 30 min. The pellets were counterstained with 10 μg/ml DAPI (Sigma) for 5 min and mounted on confocal acquisition plates using PBS.
2.5.2 Paraffin embedding, processing, sectioning, and staining
Pellets were marked and transferred to a labeled plastic tissue cassette following a PBS wash for paraffin embedding. Besides dewaxing and paraffin embedding, the standard tissue processing protocol was performed for the whole pellet. In summary, cassettes were dehydrated for 10 min in a series of ethanol solutions of increasing concentration (70%–100%). Multiple xylene changes were then performed to ensure ethanol clearance. This was followed by wax infiltration and paraffin embedding into mold cassettes. Paraffin sections (4 μm) were obtained using a microtome on poly-L lysine (PLL) coated slides and kept at 65 °C for 2 h. Following xylene treatment, the sections were hydrated with descending grades of alcohol (100%–70%) and washed. As with the whole pellet, antigen retrieval was performed with sequential pronase and hyaluronidase treatment. This was followed by protein block and overnight primary antibody using mouse monoclonal Anti-Collagen type II antibody [DSHB Hybridoma Product II-II6B3-5 μg/mL] reconstituted with 2% BSA in PBS at 4 °C. Following a wash, the slides were treated with a protein block solution for 5 min and then a secondary antibody (Alexa Fluor® 594 at 1: 100 dilution, 30 min). Counterstaining with 10 μg/ml DAPI (Sigma) for 5 min was followed by mounting with 90% glycerol.
2.6 Imaging and quantification of fluorescence intensity
The collagen type II imaging was performed using an Olympus laser scanning confocal microscope FV1000 model. After adjustment for optimal exposure, the uninduced and induced pellets were imaged using the same settings. Olympus cellSens dimension image analysis software was used to further analyze the captured raw images and generate multi-dimensional/z-series views. Intensity profile analysis covering the entire cross-section was performed for all sequential images. The generated numerical value (arbitrary unit) for each section was used to calculate the sum and average fluorescence intensity. Since the paraffin-embedded group contained fewer optical sections than the whole pellet, estimation of the sum and average was repeated after matching for the number of sections using random number selection software (Supplementary Fig. 1). Additionally, the area of the pellet was estimated using the measurement and ROI (Region of Interest) tool.
2.7 qRT-PCR for collagen type II COL2A1 expression
Both the uninduced and induced pellets were homogenized with a help of a micro pestle using a guanidine-thiocyanate–containing lysis buffer. Total RNA was extracted from the isolate using Qiagen RNeasy Mini Kit as per the manufacturer's instructions. RNA concentration and A260/A280 absorbance were determined using a Nanodrop spectrophotometer. For cDNA construction, 42 ng of RNA was reverse transcribed using the Bio First-Strand synthesis system (Takara). Quantitative RT-PCR (1 ng of cDNA/10 μl reaction) was done using Eurogenetec Takyon™ Low Rox SYBR Master Mix Dttp Blue and carried out with QuantStudio 6K Flex thermocycler (Applied Biosystem). Analyses from the three samples were performed in technical duplicate. The primer sequence used was as follows: Collagen type II (COL2A1): forward: 5′-3’: CCTGAGTGGAAGAGTGGAGAC, reverse: 5′-3’: TTGCTGCTCCACCAGTTCTT and glyceraldehyde 3-phosphate dehydrogenase (GAPDH): forward: 5′-3’: TCAGCAATGCCTCCTGCAC, reverse: 5′-3’: TCTGGGTGGCAGTGATGGC. Relative expression for COL2A1 was normalized to the housekeeping gene GAPDH (ΔCt).
2.8 Statistical analysis
Comparison of the sum and average of fluorescence intensities between the paraffin sections and whole pellet were performed using Mann Whitney U test and, Wilcoxson sign rank test between uninduced and induced pellets. Statistical significance was concluded at a P value of <0.05. Graphical representation was performed using IGOR Pro-Version 5.0.4.8 (Wave metrics Inc.) and statistical analysis using SPSS version 21.0.
3 Results
3.1 Phenotype characterization by FACS
Characterization of passage 1 chondroprogenitors using FACS showed a high expression of CD105, CD73 and CD90, and a low expression of CD34 and CD45. As fibronectin adhesion assay was used for obtaining chondroprogenitors, integrin markers for the fibronectin receptor were also evaluated. Chondroprogenitors displayed high expression for integrin fibronectin markers: CD29 and CD49e (Fig. 2)
3.2 Confocal laser microscopy for fluorescence intensity of collagen type II using cellSens and qRT-PCR for COL2A1
Both uninduced and induced pellets maintained their 3D integrity throughout the period of pellet culture. It was observed that whole pellets in both groups were easy to identify and process, maintaining their shape throughout the staining procedure. When serial optical sections were processed into a 3D representation of the whole pellet, collagen type II labelling was observed throughout the different layers. The deposition was typically pericellular and non-uniform in distribution [Fig. 3, Online Resource 1(Video), Supplementary Fig. 1]. The complex orientation of the collagen fibers was also well appreciated.
Supplementary video related to this article can be found at https://doi.org/10.1016/j.jor.2022.03.007
The following is/are the supplementary data related to this article:Video 1Video 1
Quantification of the fluorescence intensity showed that both the uninduced and induced arms of the whole pellet groups displayed positive labelling for Collagen type II. The sum and average fluorescence intensity for Collagen Type II were comparable between the uninduced and induced arms in both paraffin and whole pellet study arms (Fig. 4A-B). Assessment of the expression of COL2A1 at the molecular level by qRT-PCR revealed that both uninduced and induced pellets displayed comparable levels of expression, revalidating the confocal findings (Fig. 4C).
When a comparison between the whole pellet and paraffin sections in both uninduced and induced study arms were performed, the whole pellets showed substantially higher values of Collagen type II. This expected outcome was due to the higher number of optical sections imaged with the whole pellet than the paraffin sections (5 μm). When the average intensity (sum/total number of imaged sections) was compared, the induced pellets showed higher values than the uninduced pellets, though not significant. Similar results were replicated when the sum and average of fluorescence intensity of thickness-matched sections were compared (Supplementary Fig. 2). Another parameter assessed was the pellet area, which was higher with the whole pellet groups compared to the paraffin sections (Fig. 4D). It must be noted that the high variation with the results in the uninduced paraffin-embedded group was due to the loss of pellet integrity during paraffin processing and sectioning.
4 Discussion
Articular cartilage-derived chondroprogenitors have been considered a potential cell-based therapy option for regenerating genuine hyaline-like cartilage.9 When compared to MSCs and chondrocytes, chondroprogenitors exhibit superiority for cartilage repair.12,15,20 In the sequence of chondrogenesis, MSCs aggregate and condense in the presence of requisite transcription factors to form chondroprogenitors, that differentiate into chondrocytes, which thereafter contribute to cartilage formation by secreting extracellular matrix.21 Though chondroprogenitors are primed for chondrogenesis, their ability to form cartilage in a 3D in-vitro setting, without being induced with growth factors has not been assessed.
Pellet culture is a well-known 3D system for assessing chondrogenic differentiation in various in-vitro models. Its high cellular density can simulate mesenchymal condensation, an occurrence during embryonic development.16,17 Moreover, it is easy to cultivate and process, which contributes to its popularity. However, one of the major limitations encountered is the non-uniform pattern of differentiation.18,22 Evaluation of the degree of chondrogenic differentiation involves paraffin embedding and sectioning of the pellet, followed by staining for glycosaminoglycans and Collagen Type II protein. The level at which a particular section is taken for staining may include areas that have undergone either sufficient differentiation or under par differentiation. This may chance misinterpretation of results and incorrect extrapolation to reflect the overall differentiation. Studying the pellet in its entirety, such as that presented in this study, offer a greater understanding of the degree to which differentiation has taken place.
The study evaluated the inherent chondrogenic potential of fibronectin adhesion assay-derived chondroprogenitors using pellet cultures. It also compared the feasibility of a novel method of processing the pellet as a whole for histological evaluation, to the standard paraffin sectioning method. Chondroprogenitor pellets received either stromal medium (uninduced) or Stem Pro chondrogenic differentiation medium (induced). The study involved assessing the expression of Collagen type II protein using confocal laser immunofluorescence microscopy, by obtaining sequential optical sections of the whole pellets and generating multi-dimensional/z-series views and comparing them with the traditional paraffin sections.
When a series of adequate optical sections of the whole pellet was further processed into a 3-D representation, it revealed extracellular matrix deposition around the nucleus and also throughout the pellet in both arms. Thus, whole pellet processing has the advantage of assessing extracellular matrix formation and degree of chondrogenic differentiation in the entire pellet and is not just limited to a few sections which may or may not exhibit adequate differentiation. One of the advantages of using the whole pellet approach was retrieving the antigen-binding sites and ensuring antibody binding within the core of the pellet. The results demonstrated that sequential enzymatic retrieval using pronase and hyaluronidase ensured reagent penetration without compromising the whole pellet's structural integrity. The complex distribution of the collagen fibrillar network was well preserved and appreciated. Another important observation was the non-uniform pattern of stain uptake in the sequential images of the whole pellet. Thus, evaluating the pellet as a whole is important to understand the chondrogenic potential of the cell rather than interpreting it based on a few sections.
Collagen type II is one of the important extracellular components of hyaline cartilage, and it serves as a specific chondrogenic marker. It aids in the formation of the fibrous network and is responsible for providing cartilage with its tensile strength.23 In a study published recently, it was found that Collagen type II also slows down osteoarthritis progression by preventing articular chondrocyte hypertrophy.24In this study, when uninduced pellets were compared with those induced with chondrogenic differentiation medium, both confocal microscopy and qRT-PCR revealed comparable collagen type II expression. Findings in this study corroborate those reported in an earlier study which reported that uninduced chondroprogenitors within a platelet-rich plasma scaffold demonstrated glycosaminoglycan deposition relative to their induced counterparts.25 In this study, we demonstrate that even in the absence of inductive or differentiation factors, chondroprogenitors in pellet culture can secrete extracellular matrix similar to hyaline cartilage, thus displaying potential as a treatment option for cartilage pathologies.
This study presents a novel whole pellet confocal approach to assess the inherent chondrogenic potential of human articular cartilage-derived chondroprogenitors. This technique can be used as part of routine pellet processing to accurately represent the degree of chondrogenic differentiation, thus an accurate depiction of its probable in-vivo behavior. However, whole pellets cannot be utilized for additional staining once processed, as with paraffin-embedded sections. Since confocal microscopy requires the use of fluorescent tag markers, the samples can be stored only for a limited period. An in-vivo analysis comparing the difference in chondrogenic potential between induced and non-induced chondroprogenitors would further merit the results of this study, assessing its translational applicability.
In conclusion, the study demonstrated that articular cartilage-derived progenitors in pellet culture, display promising inherent potential for hyaline cartilage formation. A novel method for assessing chondrogenic differentiation of the whole-cell pellet was developed using confocal immunofluorescence. This study provides crucial information for understanding the capability of chondroprogenitors and their translational applications in cartilage tissue engineering research.
Funding
This project was supported by Institutional Fluid Research Grant (IRB Min No. 11586), Christian Medical College, Vellore.
Ethical statement
All procedures involved in this study involving procurement of cartilage samples were in accordance with the ethical standards of the Institution and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.
Availability of data and material (data transparency)
Not Applicable.
Code availability (software application or custom code)
Not Applicable.
CRediT authorship contribution statement
Noel Naveen Johnson: Design of study, Data curation, and, Formal analysis, Validation, of data, Writing, Final approval of the manuscript. Soosai Manickam Amirtham: Design of study, Data curation, and, Formal analysis, Validation, of data, Writing, Final approval of the manuscript. B. Sandya Rani: Data curation, and analysis, Formal analysis, Validation, of data, Writing, Final approval of the manuscript. Solomon Sathishkumar: Formal analysis, Validation, of data, Writing, Final approval of the manuscript. Grace Rebekah: Formal analysis, Validation, of data, Writing, Final approval of the manuscript. Elizabeth Vinod: Design of study, Funding acquisition, Data curation, and, Formal analysis, Validation, of data, Writing, Final approval of the manuscript.
References
- Emerging therapies for cartilage regeneration in currently excluded “red knee” populations. NPJ Regen Med. 2019;4:12.
- [Google Scholar]
- Failures, re-operations, and complications after autologous chondrocyte implantation – a systematic review. Osteoarthritis Cartilage. 2011;19(7):779-791.
- [Google Scholar]
- Mesenchymal stem cell therapy in the treatment of osteoarthritis: reparative pathways, safety and efficacy – a review. BMC Muscoskel Disord. 2016;17
- [Google Scholar]
- Long-term outcomes after autologous chondrocyte implantation. Cartilage. 2016;7(4):298-308.
- [Google Scholar]
- High osteogenic potential of adipose- and muscle-derived mesenchymal stem cells in spinal-ossification model mice. Spine. 2017;42(23):E1342-E1349.
- [Google Scholar]
- The surface of articular cartilage contains a progenitor cell population. J Cell Sci. 2004;117(Pt 6):889-897.
- [Google Scholar]
- Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy. 2006;8(4):315-317.
- [Google Scholar]
- Identification and clonal characterisation of a progenitor cell sub-population in normal human articular cartilage. PLoS One. 2010;5(10)
- [Google Scholar]
- Characterization of human articular chondrocytes and chondroprogenitors derived from non-diseased and osteoarthritic knee joints to assess superiority for cell-based therapy. Acta Histochem. 2020;122(6):151588.
- [Google Scholar]
- Evidence of a viable pool of stem cells within human osteoarthritic cartilage. Cartilage. 2014;5(4):203-214.
- [Google Scholar]
- The comparison of equine articular cartilage progenitor cells and bone marrow-derived stromal cells as potential cell sources for cartilage repair in the horse. Vet J. 2012;192(3):345-351.
- [Google Scholar]
- Comparative analysis of gene expression between articular cartilage-derived cells to assess suitability of fibronectin adhesion assay to enrich chondroprogenitors. Knee. 2020;27(3):755-759.
- [Google Scholar]
- Cartilage progenitor cells combined with PHBV in cartilage tissue engineering. J Transl Med. 2019;17(1):104.
- [Google Scholar]
- Comparative analysis of human bone marrow mesenchymal stem cells, articular cartilage derived chondroprogenitors and chondrocytes to determine cell superiority for cartilage regeneration. Acta Histochem. 2021;123(4):151713.
- [Google Scholar]
- High density micromass cultures of embryonic limb bud mesenchymal cells: an in vitro model of endochondral skeletal development. Vitro CellDevBiol-Animal. 1999;35(5):262-269.
- [Google Scholar]
- The use of mesenchymal stem cells for chondrogenesis. Injury. 2008;39(Suppl 1):S58-S65.
- [Google Scholar]
- Three-dimensional cartilage tissue engineering using adult stem cells from osteoarthritis patients. Arthritis Rheum. 2007;56(1):177-187.
- [Google Scholar]
- Chondrogenic differentiation of human bone marrow stem cells in transwell cultures: generation of scaffold-free cartilage. Stem Cell. 2007;25(11):2786-2796.
- [Google Scholar]
- Comparative analysis of fresh chondrocytes, cultured chondrocytes and chondroprogenitors derived from human articular cartilage. Acta Histochem. 2019;13:151462.
- [Google Scholar]
- Evolving concepts of chondrogenic differentiation: history, state-of-the-art and future perspectives. Eur Cell Mater. 2015;30:12-27.
- [Google Scholar]
- Chondrogenic differentiation of human bone marrow stem cells in transwell cultures: generation of scaffold-free cartilage. Stem Cell. 2007;25(11):2786-2796.
- [Google Scholar]
- Articular cartilage: structure, injuries and review of management. Br Med Bull. 2008;87:77-95.
- [Google Scholar]
- Collagen type II suppresses articular chondrocyte hypertrophy and osteoarthritis progression by promoting integrin β1−SMAD1 interaction. Bone Res. 2019;7(1):1-15.
- [Google Scholar]
- Allogeneic platelet rich plasma serves as a scaffold for articular cartilage derived chondroprogenitors. Tissue Cell. 2019;56:107-113.
- [Google Scholar]